JSPM – @glysade/bio-parsers@4.1.8

Package Exports

@glysade/bio-parsers
@glysade/bio-parsers/parsers/index.js

This package does not declare an exports field, so the exports above have been automatically detected and optimized by JSPM instead. If any package subpath is missing, it is recommended to post an issue to the original package (@glysade/bio-parsers) to support the "exports" field. If that is not possible, create a JSPM override to customize the exports field for this package.

Readme

#Bio Parsers ##About this Repo This repo contains a set of parsers to convert between datatypes through a generalized JSON format.

Use the following files to convert to a generalized JSON format:

fastaToJson
genbankToJson
sbolXmlToJson
anyToJson    //this handles any of the above file types based on file extension

Use the following file(s) to convert from a generalized JSON format back to a specific format:

jsonToGenbank

The generalized JSON format looks like:

var generalizedJsonFormat = {
    "size" : 25,
    "sequence" : "asaasdgasdgasdgasdgasgdasgdasdgasdgasgdagasdgasdfasdfdfasdfa",
    "circular" : true,
    "name" : "pBbS8c-RFP",
    "description" : "",
    "features" : [
        {
            "name" : "anonymous feature",
            "type" : "misc_feature",
            "id" : "5590c1978979df000a4f02c7", //Must be a unique id. If no id is provided, we'll autogenerate one for you
            "start" : 1,
            "end" : 3,
            "strand" : 1,
            "notes" : {},
        },
        {
            "name" : "coding region 1",
            "type" : "CDS",
            "id" : "5590c1d88979df000a4f02f5",
            "start" : 12,
            "end" : 9,
            "strand" : -1,
            "notes" : {},
        }
    ],
}

##Useage: npm install -S bio-parsers

//To go from json to genbank:
var jsonToGenbank = require('bio-parsers').jsonToGenbank;
//or alternatively (if using the package on the front end and you want to keep memory usage low)
var jsonToGenbank = require('bio-parsers/parsers/jsonToGenbank');
//You can pass an optional options object as the second argument. Here are the defaults
var options = {
  inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive 
  inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive 
  // Example:
  // 0123456
  // ATGAGAG
  // --fff--  (the feature covers GAG)
  // 0-based inclusive start:
  // feature.start = 2
  // 1-based inclusive start:
  // feature.start = 3
  // 0-based inclusive end:
  // feature.end = 4
  // 1-based inclusive end:
  // feature.end = 5
} 
var genbankString = jsonToGenbank(generalizedJsonFormat, options)

//All of the xXXXtoJson parsers work like this:
var genbankToJson = require('bio-parsers').genbankToJson;
//or alternatively (if using the package on the front end and you want to keep memory usage low)
var genbankToJson = require('bio-parsers/parsers/genbankToJson');
//You can pass an optional options object as the third argument. Here are the defaults
var options = {
  isProtein: false, //used to strip unwanted characters
  //genbankToJson options only
  inclusive1BasedStart: false //by default feature starts are parsed out as 0-based and inclusive 
  inclusive1BasedEnd: false //by default feature ends are parsed out as 0-based and inclusive 
}
genbankToJson(string, function(result) {
  console.log(result)
  // [
  //     {
  //         "messages": [
  //             "Import Error: Illegal character(s) detected and removed from sequence. Allowed characters are: atgcyrswkmbvdhn",
  //             "Invalid feature end:  1384 detected for Homo sapiens and set to 1",
  //         ],
  //         "success": true,
  //         "parsedSequence": {
  //             "features": [
  //                 {
  //                     "notes": {
  //                         "organism": [
  //                             "Homo sapiens"
  //                         ],
  //                         "db_xref": [
  //                             "taxon:9606"
  //                         ],
  //                         "chromosome": [
  //                             "17"
  //                         ],
  //                         "map": [
  //                             "17q21"
  //                         ]
  //                     },
  //                     "type": "source",
  //                     "strand": 1,
  //                     "name": "Homo sapiens",
  //                     "start": 0,
  //                     "end": 1
  //                 }
  //             ],
  //             "name": "NP_003623",
  //             "sequence": "gagaggggggttatccccccttcgtcagtcgatcgtaacgtatcagcagcgcgcgagattttctggcgcagtcag",
  //             "circular": true,
  //             "extraLines": [
  //                 "DEFINITION  contactin-associated protein 1 precursor [Homo sapiens].",
  //                 "ACCESSION   NP_003623",
  //                 "VERSION     NP_003623.1  GI:4505463",
  //                 "DBSOURCE    REFSEQ: accession NM_003632.2",
  //                 "KEYWORDS    RefSeq."
  //             ],
  //             "type": "DNA",
  //             "size": 925
  //         }
  //     }
  // ]
},options)

You can see more examples by looking at the tests.

##Editing This Repo: ###All collaborators: Edit/create a new file and update/add any relevant tests. Make sure they pass by running npm test

##Debug:

mocha ./test --inspect --debug-brk

##Updating this repo: ###Teselagen collaborators: Commit and push all changes Sign into npm using the teselagen npm account (npm whoami)

npm version patch|minor|major
npm publish

###Outside collaborators: fork and pull request please :)