Package Exports
- drptranslator
This package does not declare an exports field, so the exports above have been automatically detected and optimized by JSPM instead. If any package subpath is missing, it is recommended to post an issue to the original package (drptranslator) to support the "exports" field. If that is not possible, create a JSPM override to customize the exports field for this package.
Readme
NOTICE
Since version 1.2.0 This library requires you to use node 6+
Hello everyone!
Welcome to DNA-RNA-Protein Translator or if you may drptranslator I have a very bad problem of naming but don't let that stop you!
DRPTranslator is a small library written in typescript, this is intended for a really low entry level of genetics, nothing really advanced since I'm not a genetist after all. However if you want this to help someone at school this can suit you well :)
At the moment these are some of the usages of the principal uses:
- Translate a DNA sequence into a RNA sequence
- Obtain the complementary DNA sequence from another DNA sequence
- Translate directly from DNA to an Aminoacid sequence
- Translate RNA to an Aminoacid sequence
- Find starts and stops codons in a sequence
and some other cool stuff like a obtaining a codon array or find the first and last start and stop sequence.
Install
how can you consume this library? this is intended to be used in a nodejs environment so you can install it as a dependency
npm install --save drptranslator
Usage
Tou can Test it Here Javascript
const { RNATranslator, DNATranslator } = require("drptranslator");
const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"Typescript
import { RNATranslator, DNATranslator } from "drptranslator";
const rTranslator = new RNATranslator();
const dTranslator = new DNATranslator();
const rnaAaSeq = rTranslator.transRNAtoAA("AUGGUCUGC");
const dnaAaSeq = dTranslator.transDNAtoAA("ATGGTCTGC");
const rnatodna = rTranslator.transRNAtoDNA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const arnAASeq = rTranslator.transRNAtoAA("CCGAUCGAUCGCGAUCGAUCUUGCUCA");
const dnaAASeq = dTranslator.transDNAtoAA("GGCTAGCTAGCGCTAGCTAGAACGAGT");
console.log(rnaAaSeq, dnaAaSeq, arnAASeq, rnatodna, dnaAASeq);
// "Met-Val-Cys"
// "Tyr-Gln-Thr"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"
// "GGCTAGCTAGCGCTAGCTAGAACGAGT"
// "Pro-Ile-Asp-Arg-Asp-Arg-Ser-Cys-Ser"What's next?
- Document source files
- Creating a website for its API docs
- Publish a demo of an app using the library
- Adding more cappabilities
Suggestions
If you have an idea or you want to help to make this something bigger, raise an issue :) I'm glad to check out your ideas!