JSPM

  • ESM via JSPM
  • ES Module Entrypoint
  • Export Map
  • Keywords
  • License
  • Repository URL
  • TypeScript Types
  • README
  • Created
  • Published
  • Downloads 733
  • Score
    100M100P100Q103583F
  • License MIT

Parse sequence files (GenBank, FASTA, SnapGene, SBOL) and accession IDs (NCBI, iGEM) to a common format

Package Exports

  • seqparse
  • seqparse/dist/index.js

This package does not declare an exports field, so the exports above have been automatically detected and optimized by JSPM instead. If any package subpath is missing, it is recommended to post an issue to the original package (seqparse) to support the "exports" field. If that is not possible, create a JSPM override to customize the exports field for this package.

Readme

seqparse

Parse sequence files (GenBank, FASTA, JBEI, SnapGene, SBOL) or accession IDs (NCBI, iGEM) to a simple, common format:

interface Seq {
  name: string;
  type: "dna" | "rna" | "aa" | "unknown";
  seq: string;
  annotations: Annotation[];
}

interface Annotation {
  name: string;
  start: number;
  end: number;
  direction?: number;
  color?: string;
  type?: string;
}

Installation

npm i seqparse

To install the CLI globally:

npm i -g seqparse

Examples

Library

import seqparse from "seqparse";

const { name, type, seq, annotations } = await seqparse(file);

CLI

Example outputs are truncated for clarity.

# parse files
$ seqparse pBbE0c-RFP.gb
{
  "name": "pBbE0c-RFP",
  "type": "dna",
  "seq": "cagctagctcagtcctaggtactgtgctagctacta...",
  "annotations": [
    {
      "name": "colE1 origin",
      "start": 1234,
      "end": 1917,
      "direction": -1,
      "type": "rep_origin"
    },
...

# parse files from stdin
$ cat pBbE0c-RFP.fasta | seqparse
{
  "name": "pBbE0c-RFP.1",
  "type": "dna",
  "seq": "cagctagctcagtcctagg...",
  "annotations": []
}

# parse files then use jq to get seqs alone
$ seqparse j5.SBOL.xml | jq -r '.seq'
ggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgc

# fetch and parse remote sequence files
$ seqparse NC_011521
{
  "name": "NC_011521",
  "type": "dna",
  "seq": "cccatcttaagacttcacaagactt...",
  "annotations": [
    {
      "name": "HS566_RS00005",
      "start": 6,
      "end": 285,
      "direction": -1,
      "type": "gene"
    },
...